A method for genetically barcoding Drosophila is developed and used to tag defined cell populations in vivo for single-cell transcriptomics experiments and to enable multiplexed behavioral analysis.
PCR was developed in 1983 ... DNA or cDNA as a template during repeated cycles of heat denaturation, primer annealing and primer extension. With each cycle the amount of template DNA is doubled ...
PCR was carried out using Taq DNA Polymerase (Sigma Chemical Co., St. Louis, MO). Upstream and downstream primer sequences ... for further comparison. Annealing time and temperature see Table ...
The length of DNA oligomers, which must be between 18 and 30 nucleotides to have good annealing efficiency to the target DNA, can influence the formation of hairpins that affect the PCR reaction [28].
A triplex crystal digital PCR (cdPCR) was established on the basis ... was used to optimize various parameters of the cdPCR, i.e., the annealing temperature, reaction cycles, and the primer and probe ...
primer annealing at 25°C for 2 min, cDNA synthesis at 55°C for 30 min, and heat inactivation at 95°C for 1 min. The synthesized cDNAs were used as templates for PCR without purification. Figure 1. The ...
This study provides a valuable new resource to investigate the molecular basis of the particular features characterizing the pipefish embryo. The authors found both unique and shared gene expression ...
PCR amplification of exon 5 of the TDRD9 gene (NM_153046) was performed using the forward: CAACAGAGGACACCAGGCTA and reverse: GCACAAAGACAGGGTTCACA (annealing temperature 62°C) primers. Direct ...
Subsequently, the reverse transcriptase reaction mixture was used for PCR amplification with forward and reverse oligonucleotide primers, using a PCR kit with ... heat denaturation (94°C for 1.5 ...
annealing for 1 min at 55ËšC, extension for 1.5 min at 72ËšC, followed by a final extension for 7 min at 72ËšC. PCR mixtures (50 μL) contained 41.2 μL of deionized H 2 O, 5.0 μL of 10 × PCR buffer, 1.0 ...
Despite growing interest in using PCR materials in packaging to reduce virgin plastic use, producers and recyclers report ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results